NIH "Advancements" In Autism Lecture
By Katie Wright
I have to hand it to Dr. Jeremy Veenstra-Vanderweele (henceforth referred to as VV). Somehow, despite a decade of failure into “rare genetic subtypes = ASD treatment” research, VV remains optimistic. But I suppose it is easy to be optimistic when you are spending other people’s money, right? Why give up if you are being handsomely subsidized to fail? This is the classic autism research business model! Right out of Dr. Rob Ring’s and Dr. Tom Insel’s playbook: keep failing and blame consumers for being too “demanding.”
The title of Dr. VV’s lecture was unintentionally funny: “Research Pathways to Autism Treatment.” For years, the “pathways” Dr. VV has been speaking about so optimistically have sadly run straight into brick walls. Dr VV and his colleagues have achieved exactly 0.0 successes, but you or I knew this would be the case all along, right? Assuming the study of tiny genetic subtypes would yield treatment interventions applicable to all never made any sense.
VV, Buxbaum, Rob Ring, Paul Wang, Mark Bear etcetera … have all bet the house (with our money) that the study of ASD people with rare chromosomal abnormalities will yield treatment for all those with non-syndromic autism. The idea was SO naïve from day one. One cannot successfully drug autism away. Successfully treating the debilitating symptoms of autism involves matching the problem with a solution.
I wish those FX, TS, McPhelan families nothing but the greatest success. They are fighting the same battle as you and I. FX, TS and McPhelan Moms and Dads want better lives for their kids. Their kids deserve better lives. Unfortunately, what helps kids with “syndromic autism” is unlikely to help the other 95% of autism families.
Recently a MIND researcher finally got curious about why “ASD genetic subtype” research never succeeds. What took her so long, right? Anyway she was studying a group of “ASD” kids with the 22q deletion. Upon closer examination of the group the investigator discovered that none of the 22q kids in the autism study actually meet the criteria for autism! Yes, these children have cognitive challenges and sometimes sensory issues but that is the sum total of the commonalities. Could it be that the “autism is genetic” research industry has been shoehorning non-autistic kids into the ASD category because it fits their storyline (autism IS genetic)?
Christian’s school used to accept a number of FX and Angelman’s kids but it always turned out to be a bad fit. Socially none were really on the spectrum and rarely needed the type of treatment the moderate to severe ASD kids in the school receive. The school’s director began to believe most of these children had been misdiagnosed with ASD. The cognitive challenges presented by FX are similar to autism but no more akin to autism than Down Syndrome is to autism.
Despite the massive absence of success in the “rare chromosomal disorders will = ASD treatment,” academia’s enthusiasm for this research has not dimmed at all. Quite the opposite! So many researchers jumped on this bandwagon years ago, thrilled to be able to pursue this politically super safe, easily fundable “autism is genetic” science. The fact that almost no one in the real world autism community wants this research is as immaterial as all consumer and taxpayer concerns are at the NIH. Too bad! The dozens upon dozens of FX/TS ASD- abs must keep going!
Let’s examine the “Pathways to Treatment”
J & J: Risperdone. FAILURE – additionally J & J lied about the significant and dangerous nature of Risperdal side effects and was fined hundreds of millions by the Justice Dept.
Novartis: mGluR5. FAILURE
Seaside: Baclofen. FAILURE
Roche: EU AIMS. FAILURE
Autism Speaks: PACT. FAILURE
AS Science President Dr. Rob Ring blew over $2 million of AS money on PACT – basically another rare genetic subtype = treatment project. That project has also yielded 0.0 successes. Ring also blew over one million dollars of AS money on EU AIMS which has achieved nothing but endless talk and empty promises.
VV tried to spin this never-ending series of failures by hypothesizing that the drugs could have failed because investigators were testing “wrong dose, wrong amount…” More like Wrong Everything. Wrong hypothesis, wrong controls, wrong study design and wrong intervention…Dr. VV admitted “the results thus far have been a little depressing,” but that we can “still expect his research to yield potential treatments.” Why? How? Based on what? It’s like a genetic research fantasyland.
I read a fascinating paper by Moss and Howlin from Kings College London called “ASD and Genetic Syndrome.” The authors found, upon close examination, that the vast majority children with “syndromic autism” do not meet criteria for ASD diagnosis. Yes, many children with FX, Angelmans and 22q share cognitive challenges and sometimes sensory issues but kids with MS, Cerebral Palsy and advanced Lyme Disease all suffer similarly and the vast majority are not on spectrum. Doctors are quick to diagnose these children with autism if they see intellectual disability. Many doctors believe they are helping these children gain access to more intense therapeutic services with an ASD diagnosis. Giving an ASD diagnosis to kids with Fragile X is almost a matter of course; rarely is a full battery of tests even performed.
My feeling is that if an ASD diagnosis helps a Fragile X kid, good for them. Great! However, to use kids with “syndromic autism” as templates for all ASD kids is absurd. Clearly, so crystal clearly, none of this research is succeeding.
f only the NIH actually cared about a return on our investment! After 10 years of nonstop failure one would think they would have let go of the “syndromic autism” model, but no, they continue to invest a massive amount of funds into this politically palatable dead end.
While NIH-funded researchers, ACE centers and the Autism Treatment Centers fund endless “learn the signs,” brain-imaging (guess what -- ASD peoples’ brains are less responsive to social cues! Study #250) and Fragile X-going-nowhere science (11,000 such studies!), these are examples of the innovative and relevant ASD research being paid for by our families.
1) Methylation, redox, immune dsyregulation, identifying and treating – Dr. R Deth
2) Diagnosing and treating metabolic and mitochrindrial disorders in ASD – Dr R. Frye
3) PANDAS treatment in ASD -- Dr. R Trifiletti
4) Treating allergies, chronic constipation and sleep problems – Dr. J Kartzinel
5)Lyme disease, Autism and Autoimmunity- Dr. K Bock
All these researchers studied common problems in the general ASD population (not problems among the 5% with rare chromosomal issues) AND developed real treatment interventions. Once again, they studied REAL problems and created solutions.
If only the NIH had invited Frye, Deth, Trifiletti or Bock to lecture on actual “Pathways to Autism Treatment!” These researchers actually have some something to share, rather than endless, expensive failure we subsidize.
“Autism in Fragile X syndrome: a Category Mistake?” Reiss et al. 2010
“The Fragile X Syndrome -- Autism: what do we really know?” Thurman et al. 2014
--
Katie Wright is Contributing Editor to Age of Autism.
Betty Bona - Fragile X is the result of successive mutation - it gets worse with each successive generation. The X chromosome has damage - extra repeats at the end of the chromosome. A person with over 45 repeats is said to be a carrier. A carrier can pass along FXS to their children 50% of the time. If the carrier has enough repeats, the gene continues to mutate in successive generations and once a person has 200 or more repeats, they have full blown Fragile X syndrome. A woman who is a carrier can have a child with normal repeats, a child with carrier status or it can mutate to full blown FXS. One in 152 women is a carrier so there will be more FXS in the next generation and even more after that. Many people don't discover FXS in their families until a full mutation child is born. That's because the gene may not have mutated yet. Furthermore, this is complicated by the fact that women have 2 X chromosomes (males only have one which is why more males are affected) only one of which can be affected. The extra X turns off so if the damaged FXS X is turned off, a woman would have no symptoms. In addition, there are 2 major diseases that only FXS carriers (not full mutation) get - FXTAS which is a degenerative Parkinson/Alzheimer like disorder, and FXPOI which causes premature ovarian failure. Finally, up to 60% of FXS children also have a dual ASD diagnosis accounting for 2-6% of ASD cases but concern is that most ASD children are not tested and the fear is that many of them may actually have FXS.
Posted by: SharonG | July 06, 2016 at 08:37 PM
The medical and pharmaceutical communities and the NIH still have a responsibility to find treatments for Fragile X - whether or not those potential treatment will or will not help those with ASD. To suggest otherwise is disrespectful. Your disorder is better than someone else's disorder? Let's not forget that the rise in autism cases and the rise in money spent on autism cases is based on the number of children with the autism classification in the school systems. And many of those children have Angelman's, FXS and Down Syndrome. Do you want ASD funding cut? Sixty percent of FXS cases have a dual autism diagnosis. That's 3-6% of autism cases and let's not forget that too many ASD have never been tested. To suggest that people with FXS and autism are not "real ASD" people is closeminded. And until an effective treatment is actually found for FXS, no one knows if it will or will not be affective for ASD kids. Arbaclofen, Seaside's drug,(which is not regular Baclofen by the way) failed not because it didn't work. It failed because of the ridiculously narrow outcome results that the FDA expects for a syndrome disorder. Ask the parents of the children who lost the test drug if it didn't work and you'll find a completely different story. If you want to take away hope from ASD parents fine, but nothing gives you the right to claim that an FXS treatment shouldn't be pursued because it may not help the autism community. Ask any ASD parent who is willing to try medication if they would try a FXS drug on their children and I'll bet that most would jump at the chance to see if it helped.
Posted by: SharonG | May 11, 2016 at 07:51 AM
@Aimee Doyle: your situation sounds really really tough. Would recommend looking at options presented in Cutting-Edge Therapies for Autism, Fourth Edition & Healing the Symptoms Known as Autism - 2nd Edition.
Posted by: Concerned parent | May 11, 2016 at 12:39 AM
Thanks again for sitting through this bunch of bull crap - You sure have had to sit through a lot of it and I am sorry about that.
Posted by: Benedetta | May 10, 2016 at 08:02 PM
Your article is "Spot-on". Thank you.
Posted by: Janet Kern | May 10, 2016 at 05:25 PM
Prenatal rubella infection or prenatal exposure to valproic acid can cause autism. In the past, much research found autism associated with complications at birth. I will continue to point out research done in the 1960s and 70s revealing that 6 to 10 minutes of asphyxia at birth damages auditory centers in the brainstem. Sadly, at that time, this was viewed as "minimal brain damage" (MBD). That language development might be affected was not considered; or that postnatal maturation of the language areas might be blunted. I will continue to point out this knowledge gap.
Two papers on (1) obese and diabetic mothers and (2) spacing of births, were all that were offered as updates to the Strategic Plan question, "What caused this to happen?" As parents, we must object. I continue to submit comments for the IACC Public Record.
Betty Bona, yes; our system is not looking for prevention. Prevention should be the goal of autism research, as it was for polio research in the past.
Katie, thank you, as always, for your articulate outrage.
Posted by: Patience (Eileen Nicole) Simon | May 10, 2016 at 06:42 AM
The first genetic condition associated with autism was PKU (phenylketonuria). By now it is common knowledge that PKU can be tested for and treated by a diet low in phenylalanine.
PKU is caused by a faulty enzyme, which produces abnormal metabolites like phenyl pyruvic acid, which are toxic and damage the brain.
Research on genetic disorders associated with autism should focus on finding abnormal metabolites. In PubMed, search terms "metabolomics autism" brings up 22 citations. These are worth reading. For example Wang et al. (2015), Heberling and Dhurjati (2015), Naviaux et al. (2015), and West et al. (2014) are free online. Abstracts of the other articles are also instructive.
Posted by: Patience (Eileen Nicole) Simon | May 10, 2016 at 06:13 AM
Thank you Katie Wright for your article and John Stone's comment.
I agree with you guys completely. Scientist's obsession with the "autism gene" is almost a total waste of time. The majority of the genes that they have found to be associated to increased autism risk seem to all relate back to the same problem that John Stone talked about, an impaired/decreased ability to deal with toxic insults (John mentioned how our toxic load is increasing, they pretty much go hand in hand).
Autism "research" is becoming, if not already, like cancer research. There's no interest in finding the truth/cure, only to generate "noise" research. I just looked at the link that Mr Stone posted in his comment, and I'm completely astounded to find that 10 years ago, the government budgets almost half a billion dollars a year on human genome research.
The link also says "The Human Genome Project (HGP) spelled out the letters of the 99.9 percent of the DNA code that we all share. The haplotype map, or HapMap for short, provides detailed knowledge of the 0.1 percent that represents variation in the genome"
That was 10 years ago. Researchers know pretty much all there is to know about the human genome, at least for our common genes.
After an additional 10 years of research on that 0.1% variation on the human genome.... your article hit the nail on the head... it's been completely fruitless, yet mass public thinking still considers that the majority of chronic diseases we have today are completely genetic.
Love you guys at AoA for reporting the truth.
Posted by: whyser | May 10, 2016 at 05:47 AM
Thank you Katie
Exactly ten years ago Francis Collins, erstwile close colleague of Thomas Insel, and still then head of the Human Genome Project but latterly of the National Institutes of Health wrote to Congress:
"But genes alone do not tell the whole story. Recent increases in chronic diseases like diabetes, childhood asthma, obesity or autism cannot be due to major shifts in the human gene pool as those changes take much more time to occur. They must be due to changes in the environment, including diet and physical activity, which may produce disease in genetically predisposed persons. Therefore, GEI [Genes and Environment Initiative] will also invest in innovative new technologies/sensors to measure environmental toxins, dietary intake and physical activity, and using new tools of genomics, proteomics, and understanding metabolism rates to determine an individual's biological response to those influences."
https://www.genome.gov/18016846/
I gather that GEI is part of NIH. Collins was saying then that you have to consider the toxic load: in fact in a certain sense genes might be considered a red herring. Some people might be more genetically susceptible than others but the real issue is that people were and are being poisoned: they are being poisoned incidentally long before they fail to get enough exercise (a major obsession of Collins), and it gets incrementally worse.
And now Collins has been director NIH for all but but seven years and has been presiding over systematic failure all that time. I remember some welcoming ceremony after his appointment in which it was said that he was a man "who could speak truth unto power" but if he could and perhaps once did, he long ago threw in the towel.
I was watching Andy, Del and Polly talking to California Senator Anderson this morning. Nations will sink into the mud rather than face the real challenge.
Posted by: John Stone | May 10, 2016 at 05:01 AM
Thank u everyone. I am so appreciative of you feedback
It amazes me how isolated these academics are! At what point is 10 yrs of nonstop failure enough? Who doe son one say to these researchers- "what u are doing is not working, we need to move on."
My only guess is that it is all political. The gene zone is so comfortable and financially rewarding- there is no incentive to change if u continue to secure grants - even 4 dead end science.
Posted by: Katie Wright | May 09, 2016 at 10:25 PM
Thanks for calling out these jerks, Katie!
Always enjoy your contributions.
Posted by: Michelle B | May 09, 2016 at 08:36 PM
Thanks for all you do Katie,
Could someone visit an “Autism gene research site” and just hang around for a few days to see what they do ??? ... My gawd they must be looking franticly all damn day...
It looks like the Autism gene has been located...
ATCGATTGAGCTCTAGC MMR GATCGATTGAGCTCTAGCGGATTGA Hg GCTCTAGCGATCGATTCGAT Hib CGATTGAGCTCTAGCGATCGATTGA DTaP GCTCTAGCGATCGATTGA Al GCTCTAGCGATC
GATTGAG Hepb CTCTAGCG
It is now on to search for the Polio gene... which will explain why one toddler gets polio and a sibling does not....
Posted by: go Trump | May 09, 2016 at 07:59 PM
My son has been tested for Fragile X three times. After the first time I told them that he had already tested negative but they just ignored me. They really like running that test. The geneticist is sure that autism is a genetic condition. Is it true that they have been searching for the asthma gene for over 10 years and have not found it?
I just read a new article by Geraldine Dawson alluding that autism is linked to smoking and drinking in pregnancy. Now nobody will have to worry about autism unless they actually smoke and drink in pregnancy.
Posted by: AutismGoAway | May 09, 2016 at 02:34 PM
Many a year ago now, I had lovely talks with Dr. Deth. (He was local.) His theories are reasonable, his research doable, and yet no one really wanted to take him up on his work. When they're looking for a nifty name to hang on our era, I will propose we call it the Age of Stupidity. Greed has always been a factor, but even most greedy people know there's a limit to how far you can push. I guess even that lesson has been lost.
Posted by: Margaret | May 09, 2016 at 01:09 PM
Katie, if they didn't have 'rare genetic subtypes' to waste millions studying, they'd some other group to investigate. "Treating" autism is of course coming up with meds to reduce symptoms....symptoms they don't really want to look into anyway. The fact that no one wants to study regressive autism is proof that it's all a big cover-up. As Dr. Boyd Haley told me years ago: "If you don't want to find something, look where it's not."
Thank you so much for reporting on this. These are the people we'll remember who wasted time and money and didn't help a single child.
Anne Dachel, Media
Posted by: Anne McElroy Dachel | May 09, 2016 at 12:13 PM
Katie, I appreciate your work in this area. Someone needs to be results oriented. I think it needs to be the families. For AIDS, the only thing that worked was massive demonstrations showing that science was dragging its feet. If these people worked for any company, they would all have been fired a long time ago.
Posted by: Leah | May 09, 2016 at 12:08 PM
Relating to comment by Aimee Doyle: We did get results with the type of issues you are describing by intensive daily sauna and chelation with EDTA IVs. Chelation orally with DMSA did not appear as helpful. Was able after almost a year to almost completely eliminate Risperdal. It was previously useful in the way you mention. Perhaps this might be something to look into in the future. Good luck, that is a tough situation.
Posted by: Leah | May 09, 2016 at 12:00 PM
I can see that Big Pharma would like nothing better than to find a pill to treat autism, and with friends in high places I can see they would make the revenue stream flow in their direction while at the same time away from anything that points towards vaccines. I am so sorry for the people who are waiting for money going into real treatments. On the other hand, those searching to cure autism with the biochemical approach have created a paradigm shift in the medical field.
Posted by: kapoore | May 09, 2016 at 11:05 AM
I do think there is some connection that should be studied in comparing these genetic conditions to autism, but it's not what they are studying. I want to know if the incidences have increased, especially the incidence of severe cases compared to mild cases. Has the incidence of FX with comorbid autism increased compared to FX without autism? What about all these new genetic diseases like all the Opitz variations, and the genetic seizure disorders. Are they all increasing in incidence? Would some of these conditions have gone unnoticed if not for environmental factors like vaccines? When I first started hearing about FX back in the early 90's, I understood that many, even men, with the genetics for FX had no outward signs and were only discovered when a family genetics history was done. Surely some of these genetics, like the genetics of our autistic children, would have resulted in acceptably healthy phenotypes if not for the additional insult of vaccines, GMOs, EMFs, etc. One family I know has three sons, all with issues. One has pretty severe Angelman's Syndrome, one with pretty severe ADD, and one with Type 1 Diabetes. They all three have the sensory issues, the food sensitivities, and many other issues that plague our kids. I wonder if the child with Angelman's would be less severe if he had not been vaccinated on schedule. I'm pretty sure the other two would be healthier without vaccines. But our system is not looking for prevention, it's looking for lucrative drug treatments, so those studies aren't relevant.
Posted by: Betty Bona | May 09, 2016 at 10:37 AM
Regarding Risperidone, I just want to provide another perspective. I agree that Risperidone is a horrible drug - that J&J lied about the side effects, etc. But - my son Rory is on it. He's 26 and he's been on and off Risperidone since he was 17.
Unfortunately, it has been the ONLY drug that has helped my son's aggressive and self-injurious behaviors. We have been doing biomedical intervention since he was diagnosed at age 4 - I don't think there's a single biomed treatment we haven't tried (and we have the debt to prove it!). However, it all went to heck in a handbasket when he became an adolescent. He had terrible rages - would scream for hours at night - hit his own leg so many times all the hair fell off - punched holes in the walls - pummeled me and my husband. We had the kinds of bruises you generally only see at domestic violence shelters. His anxiety disorder, layered on top of his autism, made everything even harder.
We had never used drugs with him before - but we were desperate. Nothing biomedical or behavioral worked anymore. Over a period of several years, we tried anti-anxiety meds, anti-psychotic meds, anti-depressant meds, SSRIs. It was an awful period in all our lives. Risperidone did work to stop the behaviors. Because we hated having him on it - we tried several times to wean him off. It worked for a while and then the behaviors came back.
We'll try again to wean him off this summer. Maybe, now that he's in his mid 20's it'll be different. Wish us luck.
Posted by: Aimee Doyle | May 09, 2016 at 09:50 AM
Bob,
And who received those millions? Did any of it go to the children who were harmed? Or did it go into government coffers as part of a cooperative skimming operation? Is this how the scam goes? They stand by and watch crimes being committed and then when the profits reach a certain level, they step in to slap hands and take their share? Then they go back into their offices and wait for the next haul?
Posted by: Linda1 | May 09, 2016 at 09:12 AM
Katie,
Thank you for continuing to highlight this. I agree with you that resources are missallocated. A very small amount of resources are going towards the biochemistry of autism and most importantly therapeutics targeted to it. As you may have seen the IACC recently came out with their list of most important research advances for 2015. There was nothing on biochemistry and the only therapeutic mentioned was oxytocin which is a hormone which is upstream of the metabolic issues that most with autism have and therefore is likely to be ineffective.
In case it is of interest I have started an interview series focused on researchers who are advancing knowledge in autism biochemistry and therapeutics. Among those I have interviewed are Dr. Frey and Dr. Deth who are both on your list. I haven't transcribed the interview for Dr. Deth yet though. Here is the link: https://autismrc.com/
Posted by: Seth Bittker | May 09, 2016 at 07:36 AM
Bob
Yes, the people who are "penalised" are the shareholders who may regard it all as a reasonable risk, but it it does not affect the corporate employees people who perpetrated the harm. Not only do they not go to jail, they will no doubt continue to collect income and bonusses unaffected. It is a perfectly stupid system.
Posted by: John Stone | May 09, 2016 at 07:15 AM
" J & J Risperdone FAILURE – additionally J & J lied about the significant and dangerous nature of Risperdal side effects and was fined hundreds of millions by the Justice Dept."
Here is a 22 minute segment on Sharyl Attkisson's show .. "Full Measure" .. regarding the tragic damage done to children (boys) prescribed J&J's Risperdal drug.
http://fullmeasure.news/news/shows/full-measure-may-01-2016
That J&J sent their drug merchants into the offices of doctors telling them Risperdal was approved for children while they knew the drug had never been tested on children .. should have resulted in prosecutions for CRIMES .. finding those GUILTY .. THEN SENTENCED TO LENGTHY JAIL TERMS.
Fining J&J "millions of dollars" is NOT JUSTICE FOR THE CHILDREN SO TRAGICALLY DAMAGED .. THESE PEOPLE MUST GO TO JAIL WHEN THEY ARE FOUND SO RECKLESSLY NEGLIGENT WHEN PUSHING THEIR "SAFE DRUGS".
Posted by: Bob Moffit | May 09, 2016 at 06:38 AM